Resumen de Structural and functional studies of at-rich dna ligands and their effect on trypanosoma brucei
AT-rich sequences confer unique properties to DNA, such as high polymorphism and flexibility. The abundance of AT-rich DNA in several pathogens¿ genomes and the ability of specific molecules to selectively target AT base pairs have prompted studies on ligands that interact with the minor groove of high AT content DNA. Of special interest are kinetoplastid parasites, such as Trypanosoma brucei, the causative agent of sleeping sickness, which are distinguished by the presence of a very AT-rich mitochondrial DNA structure called kinetoplast.
Minor groove binding ligands have offered critical information on DNA molecular recognition, providing clinically useful strategies against diseases. Thus, the binding affinity and structural characteristics of AT-rich oligonucleotides in complex with different ligands, specifically with HMG proteins and bisimidazolinium compounds, has been chosen as the object of study.
The `High Mobility Group¿ (HMG) is a family of architectural proteins that bind to DNA and influence a myriad of essential cellular processes. This research work has focused in two HMG subfamilies: HMGA and HMGB. They bind to the minor groove of the DNA by means of AT-hook (HMGA) or HMG-box (HMGB) domains. HMGA1a(50-91), HMGB1 box B and HMGB1 box AB have been expressed and purified. High similar binding affinity to an AT-rich DNA sequence containing [AATAAT_ATTATT] has been found by SPR¿biosensor experiments for both proteins. A d[CCAATAATCGCGATTATTGG]2-HMGB1 box B complex was crystallized. The diffraction patterns of the crystal at 2.68 Å resolution presented well-defined spots revealing two diffraction orientations.
A series of derivatives of FR60 [4-((4,5-dihydro-1H-imidazol-2-yl)amino)-N-(4-((4,5-dihydro-1Himidazol-2-yl)amino)phenyl)benzamide] have been proved to be high affinity DNA binders with a preference for AT over GC-rich DNA, showing slight selectivity towards sequences containing [AATT] versus [(AT)4] or [AATAAT_ATTATT]. Furthermore, competition assays have demonstrated that JNI18 competes with HMGA1a and HMGB1 for binding to DNA and it is able to displace the proteins from their DNA binding sites. This last interaction is of prime importance, as related proteins have been found to be essential in kinetoplastid parasites.
The structure of the bis(2-aminoimidazoline) compound CDIV32 with the oligonucleotide d[AAATTT]2 partially solved at 3.10 Å resolution, displays DNA columns of stacked oligonucleotides forming apseudo-continuous helix packed in a crossed column configuration of DNA helices that are at ~90° to each other. The presence of the drug CDIV32 modulates the organization of duplexes.
The crystal structure of the complex of the oligonucleotide d[AAATTT]2 with the lead compound FR60, solved at atomic resolution of 1.25 Å (PDB-ID: 5LIT) by X-ray crystallography, is constituted of stacked oligonucleotides organized as infinite continuous parallel columns, packed in a pseudo-tetragonal configuration. The structure revealed that the drug interacts with the central [AATT] region, covers the minor groove of DNA, displaces bound water and interacts with neighboring DNA molecules as a crosslinking agent.
Finally, a functional analysis has been performed on the effect of different bis(2-aminoimidazolines) on T.brucei (>70% AT kDNA) to assess whether parasite DNA was a target for these compounds. By a combination of flow cytometry and imaging techniques such as fluorescence microscopy and TEM, it was demonstrated that these compounds have a clear effect on the S-phase of T. brucei cell cycle by inflicting specific damage on the kinetoplast. It can be concluded that the studied DNA binding compounds FR60 and JNI18 are powerful trypanocides that act directly on the kinetoplast DNA. As the compounds show 100% curative activity in a mouse model of T. b. rhodesiense infection, they are potentially an effective chemotherapeutic agent for the treatment of sleeping sickness.
